banner



1. Why Did The Dna Isolation Protocol Differ For The Plant And Animal Cells?

  • Journal List
  • J Biomol Tech
  • v.24(3); 2013 Sep
  • PMC3647704

J Biomol Tech. 2013 Sep; 24(3): 113–118.

A Comparison of Dna Extraction Methods using Petunia hybrida Tissues

Farshad Tamari

Section of Biological Sciences, Kingsborough Community Higher, Brooklyn, New York 11235, USA

Craig South. Hinkley

Section of Biological Sciences, Kingsborough Community College, Brooklyn, New York 11235, USA

Naderia Ramprashad

Section of Biological Sciences, Kingsborough Community Higher, Brooklyn, New York 11235, USA

Abstract

Extraction of Deoxyribonucleic acid from plant tissue is often problematic, as many plants contain high levels of secondary metabolites that tin interfere with downstream applications, such as the PCR. Removal of these secondary metabolites usually requires further purification of the Deoxyribonucleic acid using organic solvents or other toxic substances. In this written report, we have compared 2 methods of DNA purification: the cetyltrimethylammonium bromide (CTAB) method that uses the ionic detergent hexadecyltrimethylammonium bromide and chloroform-isoamyl alcohol and the Edwards method that uses the anionic detergent SDS and isopropyl alcohol. Our results evidence that the Edwards method works better than the CTAB method for extracting DNA from tissues of Petunia hybrida. For six of the eight tissues, the Edwards method yielded more Dna than the CTAB method. In four of the tissues, this departure was statistically significant, and the Edwards method yielded 27–lxxx% more DNA than the CTAB method. Among the unlike tissues tested, we found that buds, 4 days before anthesis, had the highest Deoxyribonucleic acid concentrations and that buds and reproductive tissue, in full general, yielded higher Dna concentrations than other tissues. In addition, DNA extracted using the Edwards method was more consistently PCR-amplified than that of CTAB-extracted Deoxyribonucleic acid. Based on these results, we recommend using the Edwards method to excerpt DNA from constitute tissues and to use buds and reproductive structures for highest Deoxyribonucleic acid yields.

Keywords: CTAB, reproductive and nonreproductive, PCR, agarose gel electrophoresis

INTRODUCTION

The genus Petunia belongs to the Solanaceae family of plants and comprises some 30 subspecies. 1 Petunia species include annual and perennial herbaceous plants and take been proposed every bit model organisms for a variety of reasons. 1,2 The flowers of Petunia are formed from cymose inflorescences, with each flower bearing 5 stamens, five sepals, and five petals, arranged in concentric whorls. 3,4 Petunia hybrida, ordinarily known as the Garden Petunia, a hybrid of Petunia axillaris and Petunia integrifolia, is a commercially valuable ornamental plant. five,vi In addition, P. hybrida has been used equally a model to study flavonoid biosynthesis, floral development, and self-incompatibility. 7 –12

Many of the same studies require Dna extraction from multiple tissue types to be used in assays, such every bit the PCR. Numerous methodologies have been developed for high-throughput and cost-effective extraction of DNA from plant tissues. These include rapid Deoxyribonucleic acid extraction protocols specifically adult for plants, likewise as methods applicable to both constitute and animal tissues. thirteen –nineteen One of the most commonly used methods to extract Deoxyribonucleic acid from plants uses the ionic detergent cetyltrimethylammonium bromide (CTAB) to disrupt membranes and a chloroform-isoamyl alcohol mixture that separates contaminants into the organic phase and nucleic acrid into the aqueous phase. 19 However, many plants contain very loftier levels of secondary metabolites, including lipids, phenolic compounds, and viscous polysaccharides that can be difficult to remove without further processing, often with organic solvents, such as phenol or other toxic compounds. 13 –15 If these contaminants are non removed, and then they ofttimes inhibit subsequent downstream assays, including PCR.

One alternative to the CTAB Dna extraction method has been developed past Edwards et al. 20 This method uses the anionic detergent SDS to solubilize membranes, followed by precipitation of Dna with isopropyl booze. It is a quick, simple, and cheap method for extracting Deoxyribonucleic acid from plants, and the Dna can be used direct for PCR amplification without further processing. The Edwards method has been used to extract DNA from various plants, including Arabidopsis, soy beans, and corn, and has also been used to extract DNA from processed foods, such as various brands of corn chips. 21,22

In this paper, we used the CTAB and Edwards methods to excerpt DNA from dissimilar tissues of P. hybrida to determine: (1) which method yields the highest DNA concentration, (2) which tissue type yields the highest DNA concentration, and (3) which method is better for extracting Deoxyribonucleic acid for PCR amplification.

MATERIALS AND METHODS

Determination of Bud Sizes

All P. hybrida plants were purchased from local nurseries in Long Island, New York, U.s.. Bud development was followed for viii buds, from when the buds were airtight and ∼1 cm in length to when the flowers opened at anthesis. The cylindrical length of buds (bud sizes) was measured daily, at approximately the same time each day, using Vernier calipers. These information were used to construct a standard curve (Fig. i) for predicting the age of the buds from subsequent experiments.

An external file that holds a picture, illustration, etc.  Object name is jbt0021301330001.jpg

Standard bend of P. hybrida mean bud sizes. Bud sizes (mm) were measured daily for eight separate buds from 4 days before anthesis (−four anthesis) until buds opened (−0 anthesis). Mean bud size and standard deviations (brackets) were plotted as a office of time (days before anthesis).

Isolation of Genomic Deoxyribonucleic acid

Two methods were used to extract DNA from three different P. hybrida plants—a CTAB method and the Edwards method. DNA was extracted from viii plant tissues: (1) young, growing leaf tissue from the apex (apical leaf), (2) mature leaf tissue from the base of the establish (mature leaf), (3) sepals, (4) anthers and pistils from a wilting flower (WF), (v) anthers and pistils from a fresh flower (FF), (6) base of the petals (petals), (7) buds without sepals, 4 days before anthesis (buds, −4 anthesis), and (8) buds without sepals, 1 day before anthesis (buds, −1 anthesis).

CTAB method

This method was modified from Doyle and Doyle. 19 For each of the eight tissues, 50 mg tissue and 100 μl CTAB isolation buffer (2% hexadecyltrimethylammonium bromide, 1.4 Thou NaCl, 0.2% β2-ME, 20 mM EDTA, 100 mM Tris-HCl, pH 8) were placed into a 1.five-ml microcentrifuge tube, and the tissue was manually crushed for five min with a plastic pestle. CTAB isolation buffer (300 μl) was added to each tube, and the tissue was crushed for another 5 min. The sample was incubated at 60°C for fifteen min with occasional mixing, and and then 400 μl chloroform/isoamyl alcohol (24:1 five/v) was added to each sample. The sample was vortexed briefly and so centrifuged for 5 min at 14,000 rpm in a microcentrifuge. The supernatant was transferred to a new 1.5-ml microcentrifuge tube, 300 μl water ice-cold isopropanol was added to the tube, and the tube was inverted 5 times to precipitate the nucleic acid. The sample was centrifuged at fourteen,000 rpm for 5 min in a microcentrifuge, and the supernatant was discarded. The pellet was air-dried for 2 h and and so resuspended in 100 μl of 10 mg Ribonuclease A (Sigma R642) in x mM Tris, pH 8.0, 1 mM EDTA (TE/RNase A buffer).

Edwards method

This method was modified from Edwards et al. xx For each of the viii tissues, l mg tissue and 200 μl of Edwards buffer (200 mM Tris, pH 8.0, 200mM NaCl, 25 mM EDTA, 0.5% SDS) were placed into a ane.5-ml microcentrifuge tube, and the tissue was manually crushed for v min with a plastic pestle. Edwards buffer (300 μl) was added, and the tissue was crushed for another 5 min. The book was and so adjusted to m μl past addition of 500 μl Edwards buffer. The sample was vortexed for fifteen s, incubated at 100°C for 10 min, then centrifuged for ten min at 2000 rpm in a microcentrifuge. The supernatant (500 μ1) was transferred to a new, one.5-ml microcentrifuge tube, and the sample was centrifuged once again for 10 min at 2000 rpm. The supernatant (400 μl) was transferred to a new, 1.five-ml microcentrifuge tube, and 400 μl ice-cold isopropanol was added. The sample was inverted gently 5 times and incubated at room temperature for 10 min. It was then centrifuged for x min at 14,000 rpm in a microcentrifuge, and the supernatant was discarded. The pellet was air-stale for x min and then resuspended in 100 μl TE/RNase A buffer.

PCR Amplification and Detection of Amplified DNA

To determine which DNA extraction method was best for PCR amplification of genomic Dna, the Deoxyribonucleic acid extracted from the 8 tissues of P. hybrida plants was used to PCR amplify a 187-bp region of a plant tubulin gene. The sequence of the forward primer is GGGATCCACTTCATGCTTTCGTCC, and the sequence of the opposite primer is GGGAACCACATCACCACGGTACAT. PCR amplification was performed in 25 μl reactions using PuReTaq Ready-To-Get PCR beads (GE Healthcare, Great britain; Catalogue #27-9559-01). The PCR bead was first dissolved in 20 μl primer/loading dye mix (vi.75 pmol of each primer, 34% sucrose, 0.02% cresol red dye), to which i μg tissue Dna was added, and the full volume was adapted to 25 μl with deionized water. Cycling weather condition were 94°C for five min; 94°C for thirty s, 60°C for 30 s, 72°C for 30 s, for 32 cycles, and 72°C for 10 min. After PCR amplification, 10 μl of the amplified DNA was separated on a two% agarose gel, and DNA was visualized past ethidium bromide staining. This protocol was adapted from a method developed at the DNA Learning Centre of Common cold Spring Harbor Laboratory. 22

Statistical Analyses

All statistical analyses, including descriptive statistics, Student's t-test, and 1-manner ANOVA, were performed using SPSS fifteen.ane for Windows (SPSS, IBM, Armonk, NY, USA) and SigmaPlot (version 12; Systat Software, Chicago, IL, USA). Unless otherwise stated, the reported statistical analyses were conducted using SPSS.

RESULTS

In this written report, two methods of DNA extraction were compared: the CTAB method and the Edwards method. Additionally, Dna was extracted from viii different tissues of three individual P. hybrida plants using both methods, and three replicates were used for each tissue type. In the constitute sciences, many investigators choose to extract Deoxyribonucleic acid from reproductive tissues or from tissues that are mitotically active. The rationale is that in both cases, at least some of the cells in the tissues accept replicated their DNA and thus, volition accept higher DNA content. For this reason, nosotros tested tissues that were reproductive in nature or were mitotically active, such as buds, every bit well as tissues that are non meiotically or mitotically active, such as sepals, petals, and mature leaves. To make up one's mind the age of buds, we followed their evolution over 4 days and found that the increase in bud size was relatively uniform from 4 days before anthesis until 1 24-hour interval before anthesis (Fig. 1). Interestingly, hateful bud size decreased from 1 day earlier anthesis to anthesis. With the use of a standard curve constructed from these data, the bud ages for buds used in Deoxyribonucleic acid extractions were determined.

Comparison of DNA Yields using the CTAB and the Edwards Methods

The overall mean Deoxyribonucleic acid concentration across all tissues using the CTAB method was 581.5 ± 240.7 μg/μl (northward=65) and for the Edwards method, was 930.3 ± 508.5 μg/μl (north=76). There was a statistically significant deviation between the ii ways using a two-tailed t-test (P<0.001). Table ane shows mean Deoxyribonucleic acid concentrations in extracts prepared from eight P. hybrida tissues using the CTAB method and the Edwards method. For the CTAB method, the hateful Deoxyribonucleic acid yields from individual tissues ranged from 341.7 (±97.6) to 897.2 (±110.7) μg/μl and for the Edwards method, 300.0 (±81.0) to 1558.3 (±337.5) μg/μl. The mean Deoxyribonucleic acid concentrations were higher using the Edwards method from all tissues tested, except mature leafs and petals. A 1-way ANOVA, followed by Tukey's a posteriori test, showed a statistically significant difference between Dna concentrations obtained using the two extraction methods for the bud and anther/pistil tissues analyzed (Samples iv, 5, seven, and 8), equally indicated by the P values provided in Tabular array 1. For these samples, Dna concentrations from the Edwards method were always statistically higher. The aforementioned was truthful for 2 other tissues (Samples 1 and 3), albeit not statistically significant.

TABLE ane

Comparison of hateful concentrations of Dna (μg/μl) isolated from reproductive and nonreproductive tissues using the CTAB method and the Edwards method

Sample Tissue CTAB method
Edwards method
P
n 10 ̄ (μg/μl) ±sd due north 10 ̄ (μg/μl) ±sd
one Apical leaf viii 790.six 130.ii 9 852.viii 230.0 ane.000
two Mature leaf 9 341.7 97.vi ix 302.8 73.four 1.000
3 Sepals 9 452.8 105.7 ix 563.9 126.9 0.997
4 Anther/pistil (WF) 3 408.3 104.1 7 1057.1 218.3 <0.001 a
5 Anther/pistil (FF) 9 575.0 147.4 9 1138.nine 283.4 <0.001 a
vi Petals ix 347.2 138.three 9 300.0 81.0 one.000
7 Buds (−iv anthesis) 9 897.2 110.vii xv 1558.iii 337.5 <0.001 a
8 Buds (−1 anthesis) 9 747.ii 169.8 9 1277.8 204.four <0.001 a

A comparing of the range of Deoxyribonucleic acid concentrations obtained from the dissimilar tissues is shown in Tabular array 2. For anthers and pistils from a WF and buds −ane-day anthesis (Samples four and 8, respectively), all replicate extractions using the Edwards method yielded higher DNA concentrations than all replicate extractions using the CTAB method. For example, in Sample 4, the maximum DNA concentration obtained using the CTAB method (525 μg/μl) is lower than the minimum DNA concentration obtained using the Edwards method (800 μg/μl). For anthers and pistils from a FF and buds −4-days anthesis (Samples five and 7, respectively), all replicate extractions, except one, yielded higher Dna concentrations using the Edwards method. Comparing the two methods, the range of DNA concentrations was similar for the other four tissues using either extraction method (Samples 1–3 and vi). Taken together, these results show that DNA concentrations were consistently college in extracts prepared using the Edwards method compared with the CTAB method.

TABLE ii

Range of Deoxyribonucleic acid concentrations obtained using the CTAB method and the Edwards method

Sample Tissue [DNA] range (μg/μl)
CTAB method Edwards method
1 Upmost foliage 650–1000 525–1125
2 Mature leaf 250–525 225–425
3 Sepals 325–600 450–825
4 Anther/pistil (WF) 325–525 800–1350 a
five Anther/pistil (FF) 350–750 750–1500 b
six Petals 175–525 150–425
7 Buds (−4 anthesis) 750–1075 925–1875 b
8 Buds (−one anthesis) 525–950 975–1625 a

Comparing of Deoxyribonucleic acid Yields from Different Tissues

The tissue that gave the highest DNA concentration for both methods was the buds at 4 days earlier anthesis (Tabular array ane, Sample 7). Buds at 1 24-hour interval before anthesis gave the 2d-highest concentration for the Edwards method (Sample viii) simply yielded slightly less DNA than apical foliage tissue (Sample one) for the CTAB method. Reproductive tissue also yielded high Dna concentrations for both methods (Samples 4 and 5) compared with nonreproductive tissue, such every bit mature leafs, sepals, and petals (Samples 2, iii, and half dozen, respectively). We believe this is considering buds and reproductive tissue possess more actively dividing cells than mature leaves, sepals, and petals and therefore, have a college Deoxyribonucleic acid content/cell. Based on these results, for maximum DNA yield, we recommend extraction from buds and reproductive structures.

PCR Amplification with Extracted DNA

An of import component of whatever DNA extraction method is its use in downstream applications. Therefore, nosotros compared PCR amplification of a institute tubulin gene using the petunia-tissue DNA extracts. Figure 2 shows a representative agarose gel containing a 187-bp fragment of constitute tubulin that was PCR-amplified from DNA of eight petunia tissues (Lanes 1–8). The relative amount of each PCR product tin exist approximated by comparing the PCR production with the 200-bp DNA fragment of the 100-bp ladder (lane Grand), which contains 62.v ng DNA. The upper half of the gel shows PCR products amplified from Deoxyribonucleic acid, extracted using the Edwards method, whereas the lower half of the gel shows PCR products from DNA extracted using the CTAB method.

An external file that holds a picture, illustration, etc.  Object name is jbt0021301330002.jpg

Comparison of PCR distension using genomic Dna purified with the Edwards method or the CTAB method. The Edwards method (upper half of gel) or the CTAB method (lower half of gel) was used to purify genomic Deoxyribonucleic acid from eight tissues of P. hybrida. The genomic DNA was used to amplify a 187-bp fragment of a plant tubulin gene, and the PCR products were separated on a two% agarose gel. The eight tissues used were: (Lane 1) young, growing leaf tissue from the apex (Apical Foliage), (Lane 2) old leaf tissue from the base of the plant (Onetime Leaf), (Lane 3) Sepals, (Lane 4) anthers and pistils from a WF [Anther/Pistal (WF)], (Lane v) anthers and pistils from a FF [Anther/Pistal (FF)], (Lane six) base of the petals (Petals), (Lane seven) buds without sepals, four days earlier anthesis [Buds (−4 anthesis)], and (Lane viii) buds without sepals, i day before anthesis [Buds (−1 anthesis)]. Lane M contains a 100-bp DNA ladder.

DISCUSSION

Our results point that the Edwards method is more than consequent in producing extracts that upshot in PCR-amplifiable Deoxyribonucleic acid than the CTAB method. Beginning, the overall amount of PCR products for Deoxyribonucleic acid extracted using the Edwards method was similar across the eight tissue types. However, the amount of PCR products was more than variable for Deoxyribonucleic acid extracted using the CTAB method—for Lanes 4–vi, there is almost no detectable PCR product. PCR amplification using DNA extracted with the CTAB method always showed more variability in the amount of PCR products, although not e'er with the aforementioned anther/pistil and petal tissue samples, every bit seen in the gel in Fig. ii (information non shown). Second, the amount of PCR product obtained from each DNA sample extracted using the Edwards method was always greater than or equal to the amount of PCR product obtained using the CTAB method. In the gel in Fig. 2, the amount of all PCR products was greater using the Edwards method than the CTAB method, except for buds −one day from anthesis (Lane 8), which was approximately equal (compare PCR products in the upper half of the gel with those in the lower half of the gel). Finally, the Edwards method worked ameliorate with tissues that were hard to grind, such as anthers (Lanes 4 and five), every bit well as tissues that were easy to grind, such equally apical leaf (Lane ane).

In conclusion, our results prove that the Edwards method works better than the CTAB method for extracting Deoxyribonucleic acid from tissues of P. hybrida. The Edwards method extracted more Dna than the CTAB method for the majority of the tissues tested. In addition, Dna extracted using the Edwards method was more consistently PCR-amplified than Deoxyribonucleic acid extracted using the CTAB method. We likewise found that buds, 4 days before anthesis, yielded the highest Dna concentrations and that in general, buds and reproductive tissue yielded higher DNA concentrations than other tissues. Another advantage of the Edwards method is that organic solvents are not required for further purification of plant material prior to PCR distension.

ACKNOWLEDGMENTS

This work was supported past grant 0516051091 of the Collegiate Science and Technology Entry Plan of the New York State Department of Instruction and grant 1R25GM62003 of the Bridges to the Baccalaureate Program of the National Institute of General Medical Sciences and a Kingsborough Community Higher President's Faculty Innovation Award to F. Tamari. The authors give thanks Gary Sarinsky and Arthur Zeitlin for grant support. We besides thank Loretta Brancaccio-Taras and Mary Ortiz for disquisitional reading of the manuscript.

DISCLOSURES

In that location are no conflicts of interest.

REFERENCES

i. Gerats T, Vandenbussche Thousand. A model system for comparative inquiry: petunia. Trends Constitute Sci 2005;ten:251–256 [PubMed] [Google Scholar]

2. Stehmann RJ, Lorenz-Lemke AP, Freitas LB, Semir J. The genus Petunia . In Gerats T, Strommer J. (eds): Petunia: Evolutionary, Developmental and Physiological Genetics, 2nd ed New York, NY, USA: Springer Life Sciences, 2009;1–28 [Google Scholar]

3. Rijpkema AS, Zethof J, Gerats T, Vandenbussche Yard. Evolution and development of the flower. In Gerats T, Strommer J. (eds): Petunia: Evolutionary, Developmental and Physiological Genetics, 2nd ed New York, NY, USA: Springer Life Sciences, 2009;199–224 [Google Scholar]

four. Rijpkema A, Gerats T, Vandenbussche K. Genetics of floral development in petunia. Adv Bot Res 2006;44:237–278 [Google Scholar]

5. Lorenz-Lemke AP, Mader G, Muschner VC, et al. Diversity and natural hybridization in a highly endemic species of Petunia (solanaceae): a molecular and ecological analysis. Molec Ecol 2006;15:4487–4497 [PubMed] [Google Scholar]

6. Dell'Olivo A, Hoballah ME, Gübitz T, Kuhlemeier C. Isolation barriers between Petunia axillaris and Petunia integrifolia (solanaceae). Evolution 2011;65:1979–1991 [PubMed] [Google Scholar]

7. Napoli C, Lemieux C, Jorgensen R. Introduction of a chalcone synthase factor into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 1990;2:279–289 [PMC free commodity] [PubMed] [Google Scholar]

8. Winkel-Shirley B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, prison cell biology, and biotechnology. Plant Physiol 2001;126:485–493 [PMC gratuitous article] [PubMed] [Google Scholar]

9. Angenent GC, Franken J, Busscher Thou, Colombo L, van Tunen AJ. Petal and stamen formation in petunia is regulated by the homeotic cistron fbp1. Establish J 1993;4:101–112 [PubMed] [Google Scholar]

10. Souer E, van Houwelingen A, Kloos D, Mol J, Koes R. The no apical meristem cistron of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordial boundaries. Cell 1996;85:159–170 [PubMed] [Google Scholar]

11. Herrero Thou, Dickinson HG. Pollen-pistil incompatibility in Petunia hybrida: changes in the pistil following compatible and incompatible intraspecific crosses. J Cell Sci 1979;36:ane–18 [PubMed] [Google Scholar]

12. Clark KR, Okuley JJ, Collins PD, Sims TL. Sequence variability and developmental expression of S-alleles in cocky-incompatible and pseudeo-self-compatible petunia. Plant Cell 1990;2:815–826 [PMC free article] [PubMed] [Google Scholar]

thirteen. Pedersen North, Russel SJ, Newton AE, Ansell SW. A novel molecular protocol for the rapid extraction of DNA from byrophytes and the utility of directly amplification of Deoxyribonucleic acid from a single dwarf male. The Bryologist 2006;109:257–264 [Google Scholar]

fourteen. Bashalkhanov S, Rajora OP. Protocol: a loftier-throughput DNA extraction system suitable for conifers. Plant Methods 2008;iv:xx. [PMC free commodity] [PubMed] [Google Scholar]

15. Bellstedt DU, Pirie Medico, Visser JC, de Villiers MJ, Gehrke B. A rapid and cheap method for the direct PCR amplification of DNA from plants. Am J Bot 2010;97:e65–e68 [PubMed] [Google Scholar]

16. Carrier Thousand, Santoni Due south, Rodier-Goud M, et al. An efficient and rapid protocol for establish nuclear Dna preparation suitable for side by side generation sequencing methods. Am J Bot 2011;98:e13–e15 [PubMed] [Google Scholar]

17. Brunel D. An alternating, rapid method of plant Deoxyribonucleic acid extraction for PCR analyses. Nucleic Acid Res 1992;20:4676. [PMC costless article] [PubMed] [Google Scholar]

18. Sharma 1000, Mishra AK, Misra RS. A uncomplicated and efficient method for extraction of genomic DNA from tropical tuber crops. Afr J Biotech 2008;7:1018–1022 [Google Scholar]

19. Doyle JJ, Doyle JL. A rapid Deoxyribonucleic acid isolation process for small quantities of fresh leafage tissue. Phytochem Balderdash 1987;19:11–15 [Google Scholar]

20. Edwards K, Johnstone C, Thompson C. A simple and rapid method for the preparation of plant genomic DNA for PCR assay. Nucleic Acids Res 1991;nineteen:1349. [PMC free commodity] [PubMed] [Google Scholar]

21. Kasajima I, Ide Y, Ohkama-Ohtsu North, et al. A protocol for rapid DNA extraction from Arabidopsis thaliana for PCR assay. Plant Mol Biol Rep 2004;22:49–52 [Google Scholar]

22. Greenomes: Detecting Genetically Modified Food by PCR. National Scientific discipline Foundation and DNA Learning Heart Common cold Leap Harbor, NY, United states of america: Cold Spring Harbor Laboratory, 2006. Retrieved 12/15/2012, from http://www.greenomes.org/experiment5.html [Google Scholar]


Articles from Journal of Biomolecular Techniques : JBT are provided here courtesy of The Association of Biomolecular Resource Facilities


Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3647704/

Posted by: perrywhearommens.blogspot.com

0 Response to "1. Why Did The Dna Isolation Protocol Differ For The Plant And Animal Cells?"

Post a Comment

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel